Skip to main content
Addgene

pUC19-Q2RX87
(Plasmid #103122)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 103122 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    NEB(New England Biolabs)
  • Vector type
    CRISPR ; Cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Q2RX87(Cas9 coding gene from Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9))
  • Insert Size (bp)
    3520
  • Mutation
    human codon-optimized

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gctgcaaggcgattaagttg
  • 3′ sequencing primer cggctcgtatgttgtgtgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-Q2RX87 was a gift from Duhee Bang (Addgene plasmid # 103122 ; http://n2t.net/addgene:103122 ; RRID:Addgene_103122)
  • For your References section:

    High-throughput construction of multiple cas9 gene variants via assembly of high-depth tiled and sequence-verified oligonucleotides. Cho N, Seo HN, Ryu T, Kwon E, Huh S, Noh J, Yeom H, Hwang B, Ha H, Lee JH, Kwon S, Bang D. Nucleic Acids Res. 2018 May 18;46(9):e55. doi: 10.1093/nar/gky112. 10.1093/nar/gky112 PubMed 29529247