pUC19-A7HP89
(Plasmid
#103082)
-
PurposeCas9 coding gene template with optimized sequence for human codon usage
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 103082 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerNEB(New England Biolabs)
-
Vector typeCRISPR ; Cloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameA7HP89(Cas9 coding gene from Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966))
-
Insert Size (bp)3112
-
Mutationhuman codon-optimized
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gctgcaaggcgattaagttg
- 3′ sequencing primer cggctcgtatgttgtgtgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-A7HP89 was a gift from Duhee Bang (Addgene plasmid # 103082 ; http://n2t.net/addgene:103082 ; RRID:Addgene_103082) -
For your References section:
High-throughput construction of multiple cas9 gene variants via assembly of high-depth tiled and sequence-verified oligonucleotides. Cho N, Seo HN, Ryu T, Kwon E, Huh S, Noh J, Yeom H, Hwang B, Ha H, Lee JH, Kwon S, Bang D. Nucleic Acids Res. 2018 May 18;46(9):e55. doi: 10.1093/nar/gky112. 10.1093/nar/gky112 PubMed 29529247