Skip to main content
Addgene

pNB23
(Plasmid #103058)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 103058 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBR322
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-OVA
  • Promoter hydrogen peroxide-inducible promoter katGp

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (unknown if destroyed)
  • 3′ cloning site EcoR I (unknown if destroyed)
  • 5′ sequencing primer pBR322ori-F GGGAAACGCCTGGTATCTTT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A short ovalbumin epitope (amino acids 319–343) was fused to GFP (pGFP_OVA) to follow the immune response to the expressed antigen. (Bumann, 2001).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNB23 was a gift from Dirk Bumann (Addgene plasmid # 103058 ; http://n2t.net/addgene:103058 ; RRID:Addgene_103058)

  • For your References section:

    Disparate impact of oxidative host defenses determines the fate of Salmonella during systemic infection in mice. Burton NA, Schurmann N, Casse O, Steeb AK, Claudi B, Zankl J, Schmidt A, Bumann D. Cell Host Microbe. 2014 Jan 15;15(1):72-83. doi: 10.1016/j.chom.2013.12.006. 10.1016/j.chom.2013.12.006 PubMed 24439899
Related items:
Commonly requested with: