-
PurposeEncodes Ebola virus minigenome with EGFP reporter gene. Minigenome is under control of the CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 103054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGGs
- Total vector size (bp) 6855
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEbola virus (ebolavirus Zaire, Mayinga) minigenome
-
Speciesebolavirus Zaire, Mayinga
-
Insert Size (bp)4754
- Promoter CAG
-
Tag
/ Fusion Protein
- 3E5E eGFP cloned into pCAGGS vector from pCDNA3.1 3E5E eGFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAG-F GCAACGTGCTGGTTATTGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS_3E5E_eGFP was a gift from Elke Mühlberger (Addgene plasmid # 103054 ; http://n2t.net/addgene:103054 ; RRID:Addgene_103054) -
For your References section:
An RNA polymerase II-driven Ebola virus minigenome system as an advanced tool for antiviral drug screening. Nelson EV, Pacheco JR, Hume AJ, Cressey TN, Deflube LR, Ruedas JB, Connor JH, Ebihara H, Muhlberger E. Antiviral Res. 2017 Aug 12;146:21-27. doi: 10.1016/j.antiviral.2017.08.005. 10.1016/j.antiviral.2017.08.005 PubMed 28807685