Skip to main content
Addgene

pCAGGS_HA-VP35_EBOV
(Plasmid #103053)

Print

Ordering

This material is available to academics and nonprofits only. Availability may be limited outside the U.S. Please log in for more information.
Item Catalog # Description Quantity Price (USD)
Plasmid 103053 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCAGGs
  • Total vector size (bp) 5831
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VP35
  • Alt name
    VP35 gene of Ebola virus
  • Species
    Zaire ebolavirus, Mayinga
  • Entrez Gene
    VP35 (a.k.a. ZEBOVgp2)
  • Promoter CAG
  • Tag / Fusion Protein
    • HA-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn 1 (unknown if destroyed)
  • 3′ cloning site Not 1 (unknown if destroyed)
  • 5′ sequencing primer CAG-F GCAACGTGCTGGTTATTGTG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS_HA-VP35_EBOV was a gift from Elke Mühlberger (Addgene plasmid # 103053 ; http://n2t.net/addgene:103053 ; RRID:Addgene_103053)

  • For your References section:

    Ebola Virus Does Not Induce Stress Granule Formation during Infection and Sequesters Stress Granule Proteins within Viral Inclusions. Nelson EV, Schmidt KM, Deflube LR, Doganay S, Banadyga L, Olejnik J, Hume AJ, Ryabchikova E, Ebihara H, Kedersha N, Ha T, Muhlberger E. J Virol. 2016 Jul 27;90(16):7268-84. doi: 10.1128/JVI.00459-16. Print 2016 Aug 15. 10.1128/JVI.00459-16 PubMed 27252530
Related items:
Commonly requested with: