Skip to main content
Addgene

pCAGGS_VP35_EBOV
(Plasmid #103050)

Ordering

This material is available to academics and nonprofits only. Availability may be limited outside the U.S. Please log in for more information.
Item Catalog # Description Quantity Price (USD)
Plasmid 103050 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAGGs
  • Total vector size (bp) 6011
  • Modifications to backbone
    pCAGGS containing additonal multiple cloning sites
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VP35 gene of Ebola virus
  • Species
    (Zaire ebolavirus, Mayinga)
  • Insert Size (bp)
    2873
  • Entrez Gene
    VP35 (a.k.a. ZEBOVgp2)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac1 (unknown if destroyed)
  • 3′ cloning site Nhe 1 (unknown if destroyed)
  • 5′ sequencing primer CAG-F GCAACGTGCTGGTTATTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS_VP35_EBOV was a gift from Elke Mühlberger (Addgene plasmid # 103050 ; http://n2t.net/addgene:103050 ; RRID:Addgene_103050)
  • For your References section:

    An RNA polymerase II-driven Ebola virus minigenome system as an advanced tool for antiviral drug screening. Nelson EV, Pacheco JR, Hume AJ, Cressey TN, Deflube LR, Ruedas JB, Connor JH, Ebihara H, Muhlberger E. Antiviral Res. 2017 Aug 12;146:21-27. doi: 10.1016/j.antiviral.2017.08.005. 10.1016/j.antiviral.2017.08.005 PubMed 28807685