Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAGGS_NP_EBOV
(Plasmid #103049)

Ordering

This material is available to academics and nonprofits only. Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 103049 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAGGs
  • Total vector size (bp) 7132
  • Modifications to backbone
    pCAGGS containing additonal multiple cloning sites
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NP gene of Ebola virus
  • Alt name
    nucleoprotein gene of Ebola virus
  • Species
    Zaire ebolavirus, Mayinga
  • Mutation
    silent mutation (T to C) at position 928 of NP gene
  • Entrez Gene
    NP (a.k.a. ZEBOVgp1)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac 1 (unknown if destroyed)
  • 3′ cloning site Nhe 1 (unknown if destroyed)
  • 5′ sequencing primer CAG-F GCAACGTGCTGGTTATTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS_NP_EBOV was a gift from Elke Mühlberger (Addgene plasmid # 103049 ; http://n2t.net/addgene:103049 ; RRID:Addgene_103049)
  • For your References section:

    An RNA polymerase II-driven Ebola virus minigenome system as an advanced tool for antiviral drug screening. Nelson EV, Pacheco JR, Hume AJ, Cressey TN, Deflube LR, Ruedas JB, Connor JH, Ebihara H, Muhlberger E. Antiviral Res. 2017 Aug 12;146:21-27. doi: 10.1016/j.antiviral.2017.08.005. 10.1016/j.antiviral.2017.08.005 PubMed 28807685