pUD628
(Plasmid
#103018)
-
Purposeexpression of a Cpf1 programming crRNA targetting ADE2 (crADE2-3.S)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 103018 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUD628
- Backbone size w/o insert (bp) 5058
- Total vector size (bp) 5058
-
Vector typeYeast Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecrADE2-3.S
-
gRNA/shRNA sequenceCCGGTTGTGGTATATTTGGTGTGGA
-
SpeciesS. cerevisiae (budding yeast)
-
GenBank IDNM_001183547
-
Entrez GeneADE2 (a.k.a. YOR128C)
- Promoter SNR52
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGGTTGTGGTATATTTGGTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUD628 was a gift from Jean-Marc Daran (Addgene plasmid # 103018 ; http://n2t.net/addgene:103018 ; RRID:Addgene_103018) -
For your References section:
FnCpf1: a novel and efficient genome editing tool for Saccharomyces cerevisiae. Swiat MA, Dashko S, den Ridder M, Wijsman M, van der Oost J, Daran JM, Daran-Lapujade P. Nucleic Acids Res. 2017 Dec 1;45(21):12585-12598. doi: 10.1093/nar/gkx1007. 10.1093/nar/gkx1007 PubMed 29106617