pAAV-synp-F-synaptophysin-GCaMP6f
(Plasmid
#102996)
-
PurposeExpresses synaptophysin fused GCaMP6f under the synapsin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102996 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 7408
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsAlthough Stable strains are highly recommended, regular strains (eg, DH5alpha) can be used for better yield.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynaptophysin-GCaMP6f
-
SpeciesH. sapiens (human), R. norvegicus (rat), Synthetic
-
Insert Size (bp)2565
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer GTCGACTCCGGAATAACTTCGTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-synp-F-synaptophysin-GCaMP6f was a gift from David Cox (Addgene plasmid # 102996 ; http://n2t.net/addgene:102996 ; RRID:Addgene_102996)