Skip to main content
Addgene

pAAV-synp-F-H2B-jRGECO1a
(Plasmid #102995)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102995 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Total vector size (bp) 6505
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Although Stable strains are highly recommended, regular strains (eg, DH5alpha) can be used for better yield.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B-jRGECO1a
  • Species
    H. sapiens (human), Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer GTCGACTCCGGAATAACTTCGTA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/433953v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-synp-F-H2B-jRGECO1a was a gift from David Cox (Addgene plasmid # 102995 ; http://n2t.net/addgene:102995 ; RRID:Addgene_102995)

  • For your References section:

    Wide-area all-optical neurophysiology in acute brain slices. Farhi SL, Parot VJ, Grama A, Yamagata M, Abdelfattah AS, Adam Y, Lou S, Jun Kim J, Campbell RE, Cox DD, Cohen AE. J Neurosci. 2019 Apr 5. pii: JNEUROSCI.0168-19.2019. doi: 10.1523/JNEUROSCI.0168-19.2019. 10.1523/JNEUROSCI.0168-19.2019 PubMed 30952812
Related items:
Commonly requested with: