Skip to main content
Addgene

STAgR_tdTomato
(Plasmid #102993)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102993 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Human gRNA Expression Vector / PCR Template for STAgR
  • Backbone manufacturer
    Stricker Lab
  • Vector type
    CRISPR ; PCR Template for STAgR Vectors
  • Promoter U6
  • Selectable markers
    TdTomato

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTGGATCCGGTACCAAGG
  • 3′ sequencing primer TTACGGTTCCTGGCCTTTTG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    STAgR_tdTomato was a gift from Stefan Stricker (Addgene plasmid # 102993 ; http://n2t.net/addgene:102993 ; RRID:Addgene_102993)

  • For your References section:

    One step generation of customizable gRNA vectors for multiplex CRISPR approaches through string assembly gRNA cloning (STAgR). Breunig CT, Durovic T, Neuner AM, Baumann V, Wiesbeck MF, Koferle A, Gotz M, Ninkovic J, Stricker SH. PLoS One. 2018 Apr 27;13(4):e0196015. doi: 10.1371/journal.pone.0196015. eCollection 2018. 10.1371/journal.pone.0196015 PubMed 29702666
Related items:
Commonly requested with: