pLENTICRISPR sgNFS1
(Plasmid
#102979)
-
PurposeCutting NFS1 genomic locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102979 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLENTICRISPR
-
Backbone manufacturerFeng Zhang
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgNFS1
-
gRNA/shRNA sequenceGGCGGATTTGCAGTTCCAGAA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_021100
-
Entrez GeneNFS1 (a.k.a. COXPD52, HUSSY-08, IscS, NIFS)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLENTICRISPR sgNFS1 was a gift from Richard Possemato (Addgene plasmid # 102979 ; http://n2t.net/addgene:102979 ; RRID:Addgene_102979) -
For your References section:
NFS1 undergoes positive selection in lung tumours and protects cells from ferroptosis. Alvarez SW, Sviderskiy VO, Terzi EM, Papagiannakopoulos T, Moreira AL, Adams S, Sabatini DM, Birsoy K, Possemato R. Nature. 2017 Nov 22. doi: 10.1038/nature24637. 10.1038/nature24637 PubMed 29168506