-
Purpose(Empty Backbone) Vector for in vivo biotinylation of a fusion protein in bacteria.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMAL-c5X
-
Backbone manufacturerNEB
- Backbone size (bp) 5675
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsNEB Shuffle T7 recommended for protein expression
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn 1 (not destroyed)
- 3′ cloning site Nhe 1 (not destroyed)
- 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
In the presence of IPTG and biotin, bacteria will generate MBP/biotinylated fusion protein.
MBP fusion protein with C-terminal MCS-TEV-AviTAG-HIS
Vector expresses BirA (Biotin ligase) from E.coli.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMal-T-Avi-His/BirA was a gift from Tonia Rex (Addgene plasmid # 102962 ; http://n2t.net/addgene:102962 ; RRID:Addgene_102962)