-
PurposeExpresses Venus-PSD-95 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102949 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4141
- Total vector size (bp) 8304
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePSD-95
-
Alt nameDLG4, SAP-90
-
SpeciesM. musculus (mouse)
-
GenBank IDNC_000077.5
-
Entrez GeneDlg4 (a.k.a. Dlgh4, PSD-95, PSD95, SAP90, SAP90A)
- Promoter CMV
-
Tag
/ Fusion Protein
- Venus Fluorescent protein (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site kpnI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGAACAACACTCAACCCTATCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-5U-Venus-PSD-95-3U was a gift from Gary Bassell (Addgene plasmid # 102949 ; http://n2t.net/addgene:102949 ; RRID:Addgene_102949) -
For your References section:
Single-Molecule Imaging of PSD-95 mRNA Translation in Dendrites and Its Dysregulation in a Mouse Model of Fragile X Syndrome. Ifrim MF, Williams KR, Bassell GJ. J Neurosci. 2015 May 6;35(18):7116-30. doi: 10.1523/JNEUROSCI.2802-14.2015. 10.1523/JNEUROSCI.2802-14.2015 PubMed 25948262