PresentER-NLVPMVATV (GFP)
(Plasmid
#102947)
-
PurposePresentER minigene encoding HLA-A*02:01 ligand NLVPMVATV (GFP)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102947 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePresentER
- Backbone size w/o insert (bp) 8300
- Total vector size (bp) 8311
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin ; GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLVPMVATV
-
Alt nameCMV pp65 HLA-A*02:01 epitope 495-503
-
Alt namepp65 495-503
-
SpeciesSynthetic; Cytomegalovirus
-
Insert Size (bp)27
-
GenBank ID
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer GTTCGACCCCGCCTCGATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/09/22/267047 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PresentER-NLVPMVATV (GFP) was a gift from David Scheinberg (Addgene plasmid # 102947 ; http://n2t.net/addgene:102947 ; RRID:Addgene_102947) -
For your References section:
Identification of the Targets of T-cell Receptor Therapeutic Agents and Cells by Use of a High-Throughput Genetic Platform. Gejman RS, Jones HF, Klatt MG, Chang AY, Oh CY, Chandran SS, Korontsvit T, Zakahleva V, Dao T, Klebanoff CA, Scheinberg DA. Cancer Immunol Res. 2020 May;8(5):672-684. doi: 10.1158/2326-6066.CIR-19-0745. Epub 2020 Mar 17. 10.1158/2326-6066.CIR-19-0745 PubMed 32184297