PresentER-SIINFEKL (mCherry)
(Plasmid #102945)

• Purpose: PresentER minigene encoding H2-Kb ligand SIINFEKL (mCherry)
• Depositing Lab: David Scheinberg
• Publication: Gejman et al Elife. 2018 Nov 30;7. pii: 41090. doi: 10.7554/eLife.41090.

Backbone

• Vector backbone: PresentER
• Backbone size w/o insert (bp): 8200
• Total vector size (bp): 8321
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin ; mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SIINFEKL
• Alt name: Chicken Ovalbumin H2-Kd epitope 257-264
• Alt name: OVA257-264
• Alt name: OVAL
• Species: G. gallus (chicken), Synthetic
• Insert Size (bp): 24
• Mutation: OVA257-264
• Entrez Gene: OVAL (a.k.a. OVA, SERPINB14)
• Promoter: LTR

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiI (not destroyed)
• 3′ cloning site: SfiI (not destroyed)
• 5′ sequencing primer: GTTCGACCCCGCCTCGATCC

Resource Information

• Supplemental Documents:
  • PresentER-SIINFEKL (mCherry)
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/09/22/267047 for bioRxiv preprint.