pOTTC385 - pAAV CMV-IE IRES EGFP
(Plasmid #102936)

• Purpose: An AAV vector that expresses IRES EGFP under the CMV-IE promoter
• Depositing Lab: Brandon Harvey
• Publication: Nelson et al Neuroscience. 2019 Jun 23;413:77-85. doi: 10.1016/j.neuroscience.2019.06.023.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA
• Backbone manufacturer: Karl Deisseroth
• Backbone size w/o insert (bp): 2890
• Total vector size (bp): 5250
• Modifications to backbone: replaced EF1a promoter with CMV-IE, replaced DIO-hChR2-mCherry-WPRE_hGHpA with IRES-EGFP-SV40pA
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: EGFP
• Alt name: Enhanced Green Fluorescent Protein
• Species: Synthetic
• Insert Size (bp): 720
• GenBank ID:
• Promoter: CMV-IE

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CMV F: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: SV40pA R: TTCAGGTTCAGGGGGAGGTG

Resource Information

• Supplemental Documents:
  • pOTTC385 - pAAV CMV IRES eGFP.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry