Skip to main content
Addgene

pOTTC385 - pAAV CMV-IE IRES EGFP
(Plasmid #102936)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102936 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA
  • Backbone manufacturer
    Karl Deisseroth
  • Backbone size w/o insert (bp) 2890
  • Total vector size (bp) 5250
  • Modifications to backbone
    replaced EF1a promoter with CMV-IE, replaced DIO-hChR2-mCherry-WPRE_hGHpA with IRES-EGFP-SV40pA
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Alt name
    Enhanced Green Fluorescent Protein
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • GenBank ID
  • Promoter CMV-IE

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CMV F: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer SV40pA R: TTCAGGTTCAGGGGGAGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC385 - pAAV CMV-IE IRES EGFP was a gift from Brandon Harvey (Addgene plasmid # 102936 ; http://n2t.net/addgene:102936 ; RRID:Addgene_102936)
  • For your References section:

    Escalated Alcohol Self-Administration and Sensitivity to Yohimbine-Induced Reinstatement in Alcohol Preferring Rats: Potential Role of Neurokinin-1 Receptors in the Amygdala. Nelson BS, Fulenwider HD, Nennig SE, Smith BM, Sequeira MK, Chimberoff SH, Richie CT, Cheng K, Rice KC, Harvey BK, Heilig M, Schank JR. Neuroscience. 2019 Jun 23;413:77-85. doi: 10.1016/j.neuroscience.2019.06.023. 10.1016/j.neuroscience.2019.06.023 PubMed 31242442