Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOTTC946 - pAAV CMV-IE NK1R-IRES-EGFP
(Plasmid #102935)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102935 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pOTTC385
  • Backbone manufacturer
    Chris Richie
  • Backbone size w/o insert (bp) 5236
  • Total vector size (bp) 6460
  • Modifications to backbone
    NA
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NK1R
  • Alt name
    TACR1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1224
  • GenBank ID
    NM_012667.2
  • Entrez Gene
    Tacr1 (a.k.a. Tac1r)
  • Promoter CMV-IE

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CMV F: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer SV40pA R: TTCAGGTTCAGGGGGAGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC946 - pAAV CMV-IE NK1R-IRES-EGFP was a gift from Brandon Harvey (Addgene plasmid # 102935 ; http://n2t.net/addgene:102935 ; RRID:Addgene_102935)
  • For your References section:

    Escalated Alcohol Self-Administration and Sensitivity to Yohimbine-Induced Reinstatement in Alcohol Preferring Rats: Potential Role of Neurokinin-1 Receptors in the Amygdala. Nelson BS, Fulenwider HD, Nennig SE, Smith BM, Sequeira MK, Chimberoff SH, Richie CT, Cheng K, Rice KC, Harvey BK, Heilig M, Schank JR. Neuroscience. 2019 Jun 23;413:77-85. doi: 10.1016/j.neuroscience.2019.06.023. 10.1016/j.neuroscience.2019.06.023 PubMed 31242442