pCKTRBS-CbnR-ABE44898-OD
(Plasmid
#102925)
-
PurposepCKTRBS-OD derivative carrying CbnR-ABE44898-OD chimera, also known as ChBz01
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCKTRBS-OD
- Backbone size w/o insert (bp) 4158
- Total vector size (bp) 5607
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCbnR-ABE44898-OD (ChTFBz01)
-
Insert Size (bp)1449
- Promoter PtetO
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pCKPolyF1 (GAATTCGAGCTCGGTACCCGGG)
- 3′ sequencing primer pCKPolyR1 (GCGGCCGCAAGCTTGCATG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCKTRBS-CbnR-ABE44898-OD was a gift from George Church (Addgene plasmid # 102925 ; http://n2t.net/addgene:102925 ; RRID:Addgene_102925) -
For your References section:
Biosensor libraries harness large classes of binding domains for construction of allosteric transcriptional regulators. Juarez JF, Lecube-Azpeitia B, Brown SL, Johnston CD, Church GM. Nat Commun. 2018 Aug 6;9(1):3101. doi: 10.1038/s41467-018-05525-6. 10.1038/s41467-018-05525-6 PubMed 30082754