Skip to main content
Addgene

pG2J
(Plasmid #102882)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102882 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    HO-poly-KanMX4-HO
  • Backbone manufacturer
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC55758/
  • Backbone size w/o insert (bp) 6024
  • Total vector size (bp) 10502
  • Vector type
    Yeast Expression
  • Selectable markers
    KanMX4 (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    OsTIR1
  • Alt name
    Auxin Inducible Degron
  • Alt name
    AID
  • Species
    Oryza sativa
  • Insert Size (bp)
    2880
  • Promoter ADH1

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAGTATTGTGTCATGTTCG
  • 3′ sequencing primer CGAGTAAGCTTGGTACCG
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mGFP-AID
  • Alt name
    GFP
  • Alt name
    Auxin Inducible Degron
  • Alt name
    truncated AID
  • Insert Size (bp)
    1730
  • Promoter TEF1
  • Tag / Fusion Protein
    • AID(71-114) (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACAAGCTGGAGTACAACTAC
  • 3′ sequencing primer TCTAGGGTGTCGTTAATTACC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The AID(71-114) sequence was retrieved from: Morawska, M., and Ulrich, H.D. (2013). An expanded tool kit for the auxin-inducible degron system in budding yeast. Yeast 30, 341–351. The OsTIR1 was retrieved from: Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., and Kanemaki, M. (2009). An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nat. Methods 6, 917–922. mGFP was retrieved from: Saraya, R., Cepińska, M.N., Kiel, J.A.K.W., Veenhuis, M., and van der Klei, I.J. (2010). A conserved function for Inp2 in peroxisome inheritance. Biochim. Biophys. Acta 1803, 617–622. The HO-poly-KanMX4-HO plasmid was retrieved from: Voth, W.P., Richards, J.D., Shaw, J.M., and Stillman, D.J. (2001). Yeast vectors for integration at the HO locus. Nucleic Acids Res. 29, E59-9.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid can be used to assemble and characterize the auxin inducible degron in single yeast cells.

A characterization guide can be found here:
https://www.nature.com/articles/s41598-017-04791-6

Detailed description of plasmid construction can be found in the Supplemental Experimental Procedures of the original paper:
http://www.cell.com/molecular-cell/pdfExtended/S1097-2765(16)30726-2

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pG2J was a gift from Matthias Heinemann (Addgene plasmid # 102882 ; http://n2t.net/addgene:102882 ; RRID:Addgene_102882)

  • For your References section:

    Autonomous Metabolic Oscillations Robustly Gate the Early and Late Cell Cycle. Papagiannakis A, Niebel B, Wit EC, Heinemann M. Mol Cell. 2017 Jan 19;65(2):285-295. doi: 10.1016/j.molcel.2016.11.018. Epub 2016 Dec 15. 10.1016/j.molcel.2016.11.018 PubMed 27989441
Related items:
Commonly requested with: