-
PurposeExpresses rsEGFP2 in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102879 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepQE31
-
Backbone manufacturerQIAGEN
- Backbone size w/o insert (bp) 3428
- Total vector size (bp) 4148
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namersEGFP2
-
SpeciesSynthetic
-
Insert Size (bp)720
-
GenBank IDKC588954.1
-
Tag
/ Fusion Protein
- 6xHisTag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CGGATAACAATTTCACACAG
- 3′ sequencing primer CGAGCGTTCTGAACAAATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE31-rsEGFP2 was a gift from Stefan Jakobs (Addgene plasmid # 102879 ; http://n2t.net/addgene:102879 ; RRID:Addgene_102879) -
For your References section:
rsEGFP2 enables fast RESOLFT nanoscopy of living cells. Grotjohann T, Testa I, Reuss M, Brakemann T, Eggeling C, Hell SW, Jakobs S. elife. 2012;1:e00248. doi: 10.7554/eLife.00248. Epub 2012 Dec 31. 10.7554/eLife.00248 PubMed 23330067