ET8-GPIba-6His
(Plasmid #102878)

• Purpose: Wild type human platelet membrane protein GPIb alpha (1-290aa) with 6Histag at the C-terminus
• Depositing Lab: Timothy Springer
• Publication: Fu et al Nat Commun. 2017 Aug 23;8(1):324. doi: 10.1038/s41467-017-00230-2.

Backbone

• Vector backbone: ET8
• Backbone size w/o insert (bp): 5374
• Total vector size (bp): 6244
• Modifications to backbone: The ET8 vector was modified from the commercial vector pIRES2-EGFP from BD Biosciences.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Human platelet membrane protein GPIb alpha 1-290aa
• Alt name: GPIba
• Species: H. sapiens (human)
• Insert Size (bp): 870
• Entrez Gene: GP1BA (a.k.a. BDPLT1, BDPLT3, BSS, CD42B, CD42b-alpha, DBPLT3, GP1B, GPIbA, GPIbalpha, VWDP)
• Promoter: CMV promoter
• Tag / Fusion Protein:
  • 6xHis tag (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CMV Forward
• 3′ sequencing primer: TCTCGACACCCTTCTCCTCCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry