pLEX307-mFzd1
(Plasmid #102864)

• Purpose: Expresses mouse Fzd1 in mammalian cells
• Depositing Lab: Henry Ho
• Publication: Susman et al Elife. 2017 Sep 8;6. pii: e26509. doi: 10.7554/eLife.26509.

Backbone

• Vector backbone: pLEX_307
• Backbone manufacturer: Addgene #41392 (provided by David Root)
• Backbone size w/o insert (bp): 10065
• Total vector size (bp): 10656
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Frizzled 1
• Species: M. musculus (mouse)
• Insert Size (bp): 1931
• Entrez Gene: Fzd1 (a.k.a. AW227548, FZ-1, Fz1)
• Promoter: EF1A

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: EF1A promoter forward (TCAAGCCTCAGACAGTGGTTC)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Insert was PCR amplified from Addgene plasmid #42253 (provided by Jeremy Nathans and Chris Garcia) and subcloned into a modified pENTR-2B vector using FseI and AscI sites.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry