pBW_0003
(Plasmid
#102835)
-
PurposeBinary vector containing Sr22 Schomburgk allele driven by Sr33 promoter, Sr22 terminator
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102835 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepVecBARII
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSr22 Schomburgk
-
SpeciesSynthetic
-
Insert Size (bp)9871
-
Entrez GeneNEWENTRY
- Promoter Sr33 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CTTGAGTGCTGTTGGTCTTCC
- 3′ sequencing primer CGAGATGCGCCTTTGGTTATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBW_0003 was a gift from Brande Wulff (Addgene plasmid # 102835 ; http://n2t.net/addgene:102835 ; RRID:Addgene_102835) -
For your References section:
Extensive Genetic Variation at the Sr22 Wheat Stem Rust Resistance Gene Locus in the Grasses Revealed Through Evolutionary Genomics and Functional Analyses. Md Hatta MA, Ghosh S, Athiyannan N, Richardson T, Steuernagel B, Yu G, Rouse MN, Ayliffe M, Lagudah ES, Radhakrishnan GV, Periyannan SK, Wulff BBH. Mol Plant Microbe Interact. 2020 Nov;33(11):1286-1298. doi: 10.1094/MPMI-01-20-0018-R. Epub 2020 Oct 1. 10.1094/MPMI-01-20-0018-R PubMed 32779520