Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBW_0002
(Plasmid #102834)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102834 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pVecBARII
  • Vector type
    Plant Expression
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Sr22 Schomburgk
  • Species
    Synthetic
  • Insert Size (bp)
    9732
  • Entrez Gene
    NEWENTRY
  • Promoter Sr33 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CTTGAGTGCTGTTGGTCTTCC
  • 3′ sequencing primer TGCTTCAGGTGTGCTCTCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBW_0002 was a gift from Brande Wulff (Addgene plasmid # 102834 ; http://n2t.net/addgene:102834 ; RRID:Addgene_102834)
  • For your References section:

    Extensive Genetic Variation at the Sr22 Wheat Stem Rust Resistance Gene Locus in the Grasses Revealed Through Evolutionary Genomics and Functional Analyses. Md Hatta MA, Ghosh S, Athiyannan N, Richardson T, Steuernagel B, Yu G, Rouse MN, Ayliffe M, Lagudah ES, Radhakrishnan GV, Periyannan SK, Wulff BBH. Mol Plant Microbe Interact. 2020 Nov;33(11):1286-1298. doi: 10.1094/MPMI-01-20-0018-R. Epub 2020 Oct 1. 10.1094/MPMI-01-20-0018-R PubMed 32779520