pET15b-pknG
(Plasmid #102814)

• Purpose: Expression of PknG in E.coli
• Depositing Lab: Jean Pieters
• Publication: Walburger et al Science. 2004 Jun 18;304(5678):1800-4. Epub 2004 May 20.

Backbone

• Vector backbone: pET15b
• Backbone size w/o insert (bp): 5708
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pknG
• Species: Mycobacterium bovis BCG
• Promoter: T7
• Tag / Fusion Protein:
  • His (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: T7 Fwd 5'd[TAATACGACTCACTATAGGG]3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Addgene's quality control sequencing has identified a frameshift mutation near the C-terminus of the pET-15b backbone-resident Lac-I ORF. However, the depositing lab states that this mutation does not affect PknG protein expression.