APPL1-N308D-GFP
(Plasmid #102783)

• Purpose: Point mutation in APPL1 that diminishes its interaction with Rab5
• Depositing Lab: Donna Webb
• Publication: Webb Lab plasmids (unpublished)

Backbone

• Vector backbone: EGFP-C3
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: APPL1
• Species: H. sapiens (human)
• Mutation: changed asparagine 308 to aspartate; *(see below)
• GenBank ID: NM_012096.2
• Entrez Gene: APPL1 (a.k.a. APPL, DIP13alpha, MODY14)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: EGFP-C 5'd[CATGGTCCTGCTGGAGTTCGTG]
• 3′ sequencing primer: SV40pA-R GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

*Note: Addgene's quality control sequencing finds additional residues KPNSAVDGTAGPGSTGSR appended to the C-terminus of the APPL1 protein. These additional residues are not thought to affect protein function.