Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOEM-GED-EGFP
(Plasmid #102782)

Ordering

This material is available to academics and nonprofits only. This item is currently unavailable outside the US without additional regulatory approval. A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.
Item Catalog # Description Quantity Price (USD)
Plasmid 102782 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pOEM1
  • Backbone manufacturer
    MPI-CBG PEP facility
  • Vector type
    Mammalian Expression, Insect Expression ; Baculoviral rescue shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EGFP
  • GenBank ID
    U55763
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI, EagI, SalI, AccI (unknown if destroyed)
  • 3′ cloning site NheI, BmtI, AgeI (unknown if destroyed)
  • 5′ sequencing primer ACTGTGTTTGCTGACGCAAC
  • 3′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOEM-GED-EGFP was a gift from Elly Tanaka (Addgene plasmid # 102782 ; http://n2t.net/addgene:102782 ; RRID:Addgene_102782)
  • For your References section:

    Pseudotyped baculovirus is an effective gene expression tool for studying molecular function during axolotl limb regeneration. Oliveira CR, Lemaitre R, Murawala P, Tazaki A, Drechsel DN, Tanaka EM. Dev Biol. 2018 Jan 15;433(2):262-275. doi: 10.1016/j.ydbio.2017.10.008. Epub 2017 Nov 30. 10.1016/j.ydbio.2017.10.008 PubMed 29198566