pOEM-GED-EGFP
(Plasmid
#102782)
-
PurposeBaculovirus rescue vector, VSVGED pseudotype, eGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102782 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepOEM1
-
Backbone manufacturerMPI-CBG PEP facility
-
Vector typeMammalian Expression, Insect Expression ; Baculoviral rescue shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFP
-
GenBank IDU55763
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI, EagI, SalI, AccI (unknown if destroyed)
- 3′ cloning site NheI, BmtI, AgeI (unknown if destroyed)
- 5′ sequencing primer ACTGTGTTTGCTGACGCAAC
- 3′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOEM-GED-EGFP was a gift from Elly Tanaka (Addgene plasmid # 102782 ; http://n2t.net/addgene:102782 ; RRID:Addgene_102782) -
For your References section:
Pseudotyped baculovirus is an effective gene expression tool for studying molecular function during axolotl limb regeneration. Oliveira CR, Lemaitre R, Murawala P, Tazaki A, Drechsel DN, Tanaka EM. Dev Biol. 2018 Jan 15;433(2):262-275. doi: 10.1016/j.ydbio.2017.10.008. Epub 2017 Nov 30. 10.1016/j.ydbio.2017.10.008 PubMed 29198566