Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CamKIIa-ChrimsonR::FusionRed::Kv2.1
(Plasmid #102770)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102770 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5366
  • Total vector size (bp) 7352
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ChrimsonR::FusionRed::Kv2.1
  • Insert Size (bp)
    1986
  • Tags / Fusion Proteins
    • FusionRed (C terminal on insert)
    • Kv2.1 traficking domain (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTCACCAGCTACAGTCTACCTTTC
  • 3′ sequencing primer CACGTTGTAAACGCCTGGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CamKIIa-ChrimsonR::FusionRed::Kv2.1 was a gift from Karel Svoboda (Addgene plasmid # 102770 ; http://n2t.net/addgene:102770 ; RRID:Addgene_102770)
  • For your References section:

    Targeted photostimulation uncovers circuit motifs supporting short-term memory. Daie K, Svoboda K, Druckmann S. Nat Neurosci. 2021 Feb;24(2):259-265. doi: 10.1038/s41593-020-00776-3. Epub 2021 Jan 25. 10.1038/s41593-020-00776-3 PubMed 33495637