Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

sgp27#1
(Plasmid #102759)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102759 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p27
  • Alt name
    Cdkn1b
  • Alt name
    KIP1
  • gRNA/shRNA sequence
    TCAAACGTGAGAGTGTCTAA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Cdkn1b (a.k.a. Kip1, p27, p27Kip1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)
  • 3′ cloning site BsmBI (unknown if destroyed)
  • 5′ sequencing primer U6 F
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgp27#1 was a gift from Jin Chen (Addgene plasmid # 102759 ; http://n2t.net/addgene:102759 ; RRID:Addgene_102759)
  • For your References section:

    Targeting EphA2 impairs cell cycle progression and growth of basal-like/triple-negative breast cancers. Song W, Hwang Y, Youngblood VM, Cook RS, Balko JM, Chen J, Brantley-Sieders DM. Oncogene. 2017 Jun 5. doi: 10.1038/onc.2017.170. 10.1038/onc.2017.170 PubMed 28581527