Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EphA2 1-427 pcDNA3.1
(Plasmid #102737)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102737 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EphA2 N terminal (1-427aa)
  • Alt name
    Eck
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Epha2 (a.k.a. AW545284, Eck, Myk2, Sek-2, Sek2)
  • Promoter CMV
  • Tags / Fusion Proteins
    • myc (C terminal on backbone)
    • 6xHis (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer ACTGCACTCGAGGAAGCTTCGGCTAGTCACC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EphA2 1-427 pcDNA3.1 was a gift from Jin Chen (Addgene plasmid # 102737 ; http://n2t.net/addgene:102737 ; RRID:Addgene_102737)
  • For your References section:

    EPHA2 Blockade Overcomes Acquired Resistance to EGFR Kinase Inhibitors in Lung Cancer. Amato KR, Wang S, Tan L, Hastings AK, Song W, Lovly CM, Meador CB, Ye F, Lu P, Balko JM, Colvin DC, Cates JM, Pao W, Gray NS, Chen J. Cancer Res. 2016 Jan 15;76(2):305-18. doi: 10.1158/0008-5472.CAN-15-0717. Epub 2016 Jan 7. 10.1158/0008-5472.CAN-15-0717 PubMed 26744526