EphA2 1-427 pcDNA3.1
(Plasmid
#102737)
-
PurposeExpression of N terminal EphA2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102737 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEphA2 N terminal (1-427aa)
-
Alt nameEck
-
SpeciesM. musculus (mouse)
-
Entrez GeneEpha2 (a.k.a. AW545284, Eck, Myk2, Sek-2, Sek2)
- Promoter CMV
-
Tags
/ Fusion Proteins
- myc (C terminal on backbone)
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer ACTGCACTCGAGGAAGCTTCGGCTAGTCACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EphA2 1-427 pcDNA3.1 was a gift from Jin Chen (Addgene plasmid # 102737 ; http://n2t.net/addgene:102737 ; RRID:Addgene_102737) -
For your References section:
EPHA2 Blockade Overcomes Acquired Resistance to EGFR Kinase Inhibitors in Lung Cancer. Amato KR, Wang S, Tan L, Hastings AK, Song W, Lovly CM, Meador CB, Ye F, Lu P, Balko JM, Colvin DC, Cates JM, Pao W, Gray NS, Chen J. Cancer Res. 2016 Jan 15;76(2):305-18. doi: 10.1158/0008-5472.CAN-15-0717. Epub 2016 Jan 7. 10.1158/0008-5472.CAN-15-0717 PubMed 26744526