pJL1-CyPet
(Plasmid
#102636)
-
PurposeIn vitro expression of CyPet from the T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102636 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJL1
- Backbone size w/o insert (bp) 1759
- Total vector size (bp) 2476
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCyPet
-
Insert Size (bp)717
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGTTATTGCTCAGCGGTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCyPet insert is from Addgene #14030
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1-CyPet was a gift from Michael Jewett (Addgene plasmid # 102636 ; http://n2t.net/addgene:102636 ; RRID:Addgene_102636) -
For your References section:
BioBits Bright: A fluorescent synthetic biology education kit. Stark JC, Huang A, Nguyen PQ, Dubner RS, Hsu KJ, Ferrante TC, Anderson M, Kanapskyte A, Mucha Q, Packett JS, Patel P, Patel R, Qaq D, Zondor T, Burke J, Martinez T, Miller-Berry A, Puppala A, Reichert K, Schmid M, Brand L, Hill LR, Chellaswamy JF, Faheem N, Fetherling S, Gong E, Gonzalzles EM, Granito T, Koritsaris J, Nguyen B, Ottman S, Palffy C, Patel A, Skweres S, Slaton A, Woods T, Donghia N, Pardee K, Collins JJ, Jewett MC. Sci Adv. 2018 Aug 1;4(8):eaat5107. doi: 10.1126/sciadv.aat5107. eCollection 2018 Aug. 10.1126/sciadv.aat5107 PubMed 30083609