pCDH-SIRT2-Flag
(Plasmid #102624)

• Purpose: Expresses full length SIRT2 isoform 1 in mammalian cells
• Depositing Lab: Hening Lin
• Publication: Jing et al Cancer Cell. 2016 Mar 14;29(3):297-310. doi: 10.1016/j.ccell.2016.02.007.

Backbone

• Vector backbone: pCDH-CMV-MCS-EF1-Puro
• Backbone size w/o insert (bp): 7384
• Total vector size (bp): 8576
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SIRT2
• Alt name: Sirtuin 2
• Species: H. sapiens (human)
• Insert Size (bp): 1215
• GenBank ID: NC_000019.10
• Entrez Gene: SIRT2 (a.k.a. SIR2, SIR2L, SIR2L2)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CMV-Forward
• 3′ sequencing primer: CDH-Reverse, CTCTAGGCACCCGTTCAATTGC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry