pET28a-6XHis-SUMO-SIRT2
(Plasmid #102622)

• Purpose: Expresses a truncation (aa38-356) of human SIRT2 isoform 1 in bacteria for purification
• Depositing Lab: Hening Lin
• Publication: Jing et al Cancer Cell. 2016 Mar 14;29(3):297-310. doi: 10.1016/j.ccell.2016.02.007.

Backbone

• Vector backbone: pET28a-6XHis-SUMO
• Backbone size w/o insert (bp): 5633
• Total vector size (bp): 6571
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SIRT2
• Alt name: Sirtuin 2
• Species: H. sapiens (human)
• Insert Size (bp): 984
• Mutation: Deleted amino acids 1-37 and 357-389
• GenBank ID: NC_000019.10
• Entrez Gene: SIRT2 (a.k.a. SIR2, SIR2L, SIR2L2)
• Tag / Fusion Protein:
  • 6XHis-SUMO (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: T7 promoter, TAATACGACTCACTATAGGG
• 3′ sequencing primer: T7 terminator, GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry