PB-SAM-Dest
(Plasmid #102563)

• Purpose: (Empty Backbone) Piggybac transposon DEST vector encoding dCAS9-VP64 and MS2-P65-HSF1 activator helper complex. It is used for insertion of multiple U6-sgRNA expression cassettes.
• Depositing Lab: Ying Liu
• Publication: Li et al Mol Ther Nucleic Acids. 2017 Sep 15;8:64-76. doi: 10.1016/j.omtn.2017.06.007. Epub 2017 Jun 15.

Backbone

• Vector backbone: PB-SAM
• Backbone size (bp): 16156
• Vector type: Mammalian Expression, CRISPR ; piggybac transposon
• Promoter: N/A
• Selectable markers: Hygromycin, Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: catgcttggttcggatgccc
• 3′ sequencing primer: gcattacacgtcttgagc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: dCAS9-VP64 and MS2-P65-HSF1 cassettes are from Feng Zhang's lab (Addgene #61423 and #61425).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry