pCH1/RAD51o
(Plasmid #102562)

• Purpose: Express Human RAD51 protein codon optimzed for E.coli and the E.coli GorE Operon
• Depositing Lab: Maria Spies
• Publication: Subramanyam et al Proc Natl Acad Sci U S A. 2016 Oct 11;113(41):E6045-E6054. Epub 2016 Sep 26.

Backbone

• Vector backbone: pCOLADuet-1
• Backbone manufacturer: Novagen.EMD Millipore
• Backbone size w/o insert (bp): 3719
• Total vector size (bp): 6645
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: we use the plasmid to express RAD51 in E.coli Acella cells (Edge Bio) which have a RecA deletion that is required for purification.
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Homo sapiens RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) (RAD51), transcript variant 1
• Alt name: RAD51
• Alt name: DNA repair protein RAD51 homolog 1
• Alt name: RAD51A
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1020
• Mutation: Codon optimized for E.coli Expression
• GenBank ID: NM_002875.4
• Entrez Gene: RAD51 (a.k.a. BRCC5, FANCR, HRAD51, HsRad51, HsT16930, MRMV2, RAD51A, RECA)
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TCAGAGCCGCTCAGACCATAGC
• 3′ sequencing primer: TCGCACCGGCAAAACGCAG

Gene/Insert 2

• Gene/Insert name: E. coli groE operon
• Alt name: GroE
• Alt name: GroEL
• Alt name: GroES
• Species: E. Coli
• Insert Size (bp): 1986
• GenBank ID: X07850
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: cgtattgtacacggccgcataatcg
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pCH1-RAD51-Opt.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was specifically designed to allow high levels of RAD51 expression in E.coli along with the ability to incorporate non-natural amino acids using amber suppressor technology. It was used to incorporate an artificial amino acid to mimic tyrosine phosphorylation (published in Subramanyam S, et. al. (2016). Proceedings of the National Academy of Sciences 113(41):E6045-E6054).