pSG25-pBAD-tetO-deGFPssrA
(Plasmid
#102452)
-
PurposeExpresses deGFP fluorescent protein with ssrA degradation tag in E. coli. The expression is controlled by a pBAD-tetO combinatorial promoter.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102452 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneColE1
- Backbone size w/o insert (bp) 2753
- Total vector size (bp) 3428
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedeGFP
-
Alt nameGFP
-
Alt nameGreen Fluorescent Protein
-
Insert Size (bp)675
- Promoter pBAD-tetO
-
Tag
/ Fusion Protein
- ssrA (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAAACCGAATTTTGCTGGGTG
- 3′ sequencing primer ATGATAAAGAACACAGTCATAAGTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2017/04/02/123190 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG25-pBAD-tetO-deGFPssrA was a gift from Richard Murray (Addgene plasmid # 102452 ; http://n2t.net/addgene:102452 ; RRID:Addgene_102452) -
For your References section:
Construction of Incoherent Feedforward Loop Circuits in a Cell-Free System and in Cells. Guo S, Murray RM. ACS Synth Biol. 2019 Mar 15;8(3):606-610. doi: 10.1021/acssynbio.8b00493. Epub 2019 Mar 6. 10.1021/acssynbio.8b00493 PubMed 30790525
