-
PurposeMammalian expression vector for tetracycline-transactivator (rtTA), IRES-Hygro
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPBCAG-rtTAM2-IN
-
Backbone manufacturerAustin Smith lab
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametetracyclin-transactivator (rtTA)
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pCAG-F
- 3′ sequencing primer IRES-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers:
Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC
Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-CAG-rtTA-IRES-Hygro was a gift from Kian Peng Koh (Addgene plasmid # 102423 ; http://n2t.net/addgene:102423 ; RRID:Addgene_102423) -
For your References section:
Lineage-specific functions of TET1 in the postimplantation mouse embryo. Khoueiry R, Sohni A, Thienpont B, Luo X, Velde JV, Bartoccetti M, Boeckx B, Zwijsen A, Rao A, Lambrechts D, Koh KP. Nat Genet. 2017 Jul;49(7):1061-1072. doi: 10.1038/ng.3868. Epub 2017 May 15. 10.1038/ng.3868 PubMed 28504700