Skip to main content
Addgene

mAzami-Green-Galectin
(Plasmid #102419)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102419 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA6-myc his version B
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LGALS3
  • Alt name
    Galectin-3
  • Alt name
    35 kDa lectin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    765
  • GenBank ID
    NM_002306.3
  • Entrez Gene
    LGALS3 (a.k.a. CBP35, GAL3, GALBP, GALIG, L31, LGALS2, MAC2)
  • Promoter CMV
  • Tag / Fusion Protein
    • mAzami-green (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site PspOMI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The insert is from plasmid mAG-GAL3 (Addgene plasmid #62734), from the lab of Niels Geijsen and has been described in [D’Astolfo, D. S. et al. Efficient intracellular delivery of native proteins. Cell 161, 674–690 (2015)].

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The his-tag and myc-tag are NOT in frame with the Gal3-mAzami green.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mAzami-Green-Galectin was a gift from Geert van den Bogaart (Addgene plasmid # 102419 ; http://n2t.net/addgene:102419 ; RRID:Addgene_102419)

  • For your References section:

    Lipid peroxidation causes endosomal antigen release for cross-presentation. Dingjan I, Verboogen DR, Paardekooper LM, Revelo NH, Sittig SP, Visser LJ, Mollard GF, Henriet SS, Figdor CG, Ter Beest M, van den Bogaart G. Sci Rep. 2016 Feb 24;6:22064. doi: 10.1038/srep22064. 10.1038/srep22064 PubMed 26907999
Related items:
Commonly requested with: