pSIN-hSNCA-NE
(Plasmid #102366)

• Purpose: Lentiviral overexpression of synuclein alpha
• Depositing Lab: Shu Leong Ho
• Publication: Ho et al Autophagy. 2019 Apr 14:1-24. doi: 10.1080/15548627.2019.1603545.

Backbone

• Vector backbone: pSin4-EF2-IRES-Pur
• Backbone manufacturer: SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.
• Backbone size w/o insert (bp): 7500
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: synuclein alpha
• Alt name: SNCA
• Alt name: PD1; NACP; PARK1; PARK4
• Species: H. sapiens (human)
• Insert Size (bp): 477
• Mutation: A silent mutation (333bp downstream of ATG) was introduced to facilitate cloning using EcoRI, but do not affect translation of wildtype protein
• Entrez Gene: SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
• Promoter: EF-1a
• Tag / Fusion Protein:
  • NE (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: EF-1a Forward
• 3′ sequencing primer: TTAGCTTTCGTTATCATCATAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/)