pSIN-PAmCherry-KFERQ-NE
(Plasmid #102365)

• Purpose: Lentiviral overexpression of PA-mCherry-KFERQ fusion
• Depositing Lab: Shu Leong Ho
• Publication: Ho et al Autophagy. 2019 Apr 14:1-24. doi: 10.1080/15548627.2019.1603545.

Backbone

• Vector backbone: pSin4-EF2-IRES-Pur
• Backbone manufacturer: SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.
• Backbone size w/o insert (bp): 7500
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PA-mCherry
• Species: Synthetic
• Promoter: EF-1a

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: EF-1a Forward

Gene/Insert 2

• Gene/Insert name: KFERQ peptide
• Species: Synthetic
• Insert Size (bp): 825
• Promoter: EF-1a
• Tag / Fusion Protein:
  • NE (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: unknown
• 3′ sequencing primer: TTAGCTTTCGTTATCATCATAGC

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

"KFERQ" is the consensus peptide sequence found in various native proteins for mediating degradation via Chaperone-Mediated Autophagy (CMA)
There is a "NheI" restriction site which we artificially added between PAmCherry and KFERQ-NE to facilitate cloning. i.e. 5'---PAmCherry-NheI-KFERQ-NE----3'

This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/)