Skip to main content
Addgene

pSIN-PAmCherry-mSNCA-NE
(Plasmid #102364)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102364 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSin4-EF2-IRES-Pur
  • Backbone manufacturer
    SINF-EF-G (from Dr. Robert Hawley, George Washington University) was modified to make the lentiviral backbone.
  • Backbone size w/o insert (bp) 7500
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PA-mCherry
  • Species
    Synthetic
  • Promoter EF-1a

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer EF-1a Forward
  • 3′ sequencing primer TTAGCTTTCGTTATCATCATAGC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    synuclein alpha
  • Alt name
    SNCA
  • Alt name
    NACP; alphaSYN
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1182
  • Entrez Gene
    Snca (a.k.a. NACP, alpha-Syn, alphaSYN)
  • Promoter EF-1a
  • Tag / Fusion Protein
    • NE (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer unknown
  • 3′ sequencing primer TTAGCTTTCGTTATCATCATAGC
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There is a "NheI" restriction site which we artificially added between PAmCherry and SNCA-NE to facilitate cloning. i.e. 5'---PAmCherry-NheI-SNCA-NE----3'

This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIN-PAmCherry-mSNCA-NE was a gift from Shu Leong Ho (Addgene plasmid # 102364 ; http://n2t.net/addgene:102364 ; RRID:Addgene_102364)

  • For your References section:

    Age-dependent accumulation of oligomeric SNCA/alpha-synuclein from impaired degradation in mutant LRRK2 knockin mouse model of Parkinson disease: role for therapeutic activation of chaperone-mediated autophagy (CMA). Ho PW, Leung CT, Liu H, Pang SY, Lam CS, Xian J, Li L, Kung MH, Ramsden DB, Ho SL. Autophagy. 2019 Apr 14:1-24. doi: 10.1080/15548627.2019.1603545. 10.1080/15548627.2019.1603545 PubMed 30983487
Related items:
Commonly requested with: