Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHR SFFVp MCP-mCherry IRES h2b-diRFP
(Plasmid #102351)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102351 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR
  • Vector type
    Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MS2 Coat Protein
  • Alt name
    MCP
  • Promoter SFFV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcttcccgagctctataaaagagc
  • 3′ sequencing primer GATATCTCGAGTGCGGCCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR SFFVp MCP-mCherry IRES h2b-diRFP was a gift from Jared Toettcher (Addgene plasmid # 102351 ; http://n2t.net/addgene:102351 ; RRID:Addgene_102351)
  • For your References section:

    Tracing Information Flow from Erk to Target Gene Induction Reveals Mechanisms of Dynamic and Combinatorial Control. Wilson MZ, Ravindran PT, Lim WA, Toettcher JE. Mol Cell. 2017 Sep 7;67(5):757-769.e5. doi: 10.1016/j.molcel.2017.07.016. Epub 2017 Aug 17. 10.1016/j.molcel.2017.07.016 PubMed 28826673