pCDH-FLAG-R-Ras2
(Plasmid
#102335)
-
PurposeHuman R-Ras2 with FLAG tag for mammalian expression
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102335 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCDH
- Backbone size w/o insert (bp) 7384
- Total vector size (bp) 7999
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRRAS2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)615
-
GenBank IDNP_036382.2
-
Entrez GeneRRAS2 (a.k.a. NS12, TC21)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV
- 3′ sequencing primer CTCTAGGCACCCGTTCAATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-FLAG-R-Ras2 was a gift from Hening Lin (Addgene plasmid # 102335 ; http://n2t.net/addgene:102335 ; RRID:Addgene_102335) -
For your References section:
SIRT6 regulates Ras-related protein R-Ras2 by lysine defatty-acylation. Zhang X, Spiegelman NA, Nelson OD, Jing H, Lin H. Elife. 2017 Apr 13;6. pii: e25158. doi: 10.7554/eLife.25158. 10.7554/eLife.25158 PubMed 28406396
