pCDH-SIRT6-G60A
(Plasmid #102326)

• Purpose: Human SIRT6 G60A for mammalian expression
• Depositing Lab: Hening Lin
• Publication: Zhang et al Nat Chem Biol. 2016 Aug;12(8):614-20. doi: 10.1038/nchembio.2106. Epub 2016 Jun 20.

Backbone

• Vector backbone: pCDH
• Backbone size w/o insert (bp): 7348
• Total vector size (bp): 8452
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SIRT6
• Species: H. sapiens (human)
• Insert Size (bp): 1068
• Mutation: changed glycine 60 to alanine
• GenBank ID: CR457200
• Entrez Gene: SIRT6 (a.k.a. SIR2L6, hSIRT6)
• Promoter: CMV
• Tag / Fusion Protein:
  • None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CMV
• 3′ sequencing primer: CTCTAGGCACCCGTTCAATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry