pINDUCER dCas9-TET1CDMut
(Plasmid #101920)

• Purpose: The dCas9-TET1CDMut fusion protein is cloned into the pINDUCER lentiviral backbone (Addgene plasmid# 46948). The TET1 catalytic domain is mutated to abolish catalytic function.
• Depositing Lab: Danwei Huangfu
• Publication: Verma et al Nat Genet. 2018 Jan;50(1):83-95. doi: 10.1038/s41588-017-0002-y. Epub 2017 Dec 4.

Backbone

• Vector backbone: pINDUCER21 (ORF-EG)
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 10591
• Total vector size (bp): 16882
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: EGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: dCas9-TET1CD Mut
• Species: H. sapiens (human)
• Insert Size (bp): 6391
• Mutation: Mutated TET1 catalytic domain

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GGTAGGCGTGTACGGTGGGAG
• 3′ sequencing primer: TATCAACCACTTTGTACAAGA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry