pET_BGL3
(Plasmid #101912)

• Purpose: Expresses a β-glucosidase gene from Rhodothermus marinus in E. coli under the control of the pET system.
• Depositing Lab: Steve Shih
• Publication: Husser et al ACS Synth Biol. 2018 Mar 16;7(3):933-944. doi: 10.1021/acssynbio.8b00025. Epub 2018 Mar 8.

Backbone

• Vector backbone: pET16b
• Backbone size w/o insert (bp): 5711
• Total vector size (bp): 8160
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: β-glucosidase
• Alt name: bgl
• Species: Rhodothermus marinus DSM4252
• Insert Size (bp): 2520
• GenBank ID: WP_012844561.1
• Promoter: T7+LacO

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: cttcttaaagttaaacaaaattatttctagaggggaa
• 3′ sequencing primer: gcagccggatccCTACTG

Resource Information

• Supplemental Documents:
  • pet_bgl3.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry