lentiCRISPRv2-TTF-1-gRNA
(Plasmid
#101857)
-
PurposeIntroducing a gRNA targeting human TTF-1 (NKX2-1) into cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101857 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPRv2
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting TTF-1
-
gRNA/shRNA sequenceGGGGCTCCGCTGGCGGCGTAC
-
SpeciesH. sapiens (human)
-
GenBank IDNM_003317
-
Entrez GeneNKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPRv2-TTF-1-gRNA was a gift from David Mu (Addgene plasmid # 101857 ; http://n2t.net/addgene:101857 ; RRID:Addgene_101857) -
For your References section:
Thyroid transcription factor 1 enhances cellular statin sensitivity via perturbing cholesterol metabolism. Lai SC, Phelps CA, Short AM, Dutta SM, Mu D. Oncogene. 2018 Mar 19. pii: 10.1038/s41388-018-0174-7. doi: 10.1038/s41388-018-0174-7. 10.1038/s41388-018-0174-7 PubMed 29551766