Skip to main content
Addgene

Adeno BN
(Plasmid #101823)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101823 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pacAd5
  • Backbone manufacturer
    Gene Transfer Vector Core University of Iowa
  • Backbone size w/o insert (bp) 5678
  • Total vector size (bp) 11538
  • Vector type
    Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    U6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)_CBh_FLAG-Cas9
  • Alt name
    pacAd5_BN
  • gRNA/shRNA sequence
    Bcan (intron 13) Ntrk1 (intron 10)
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_001109758.1 NM_001033124.1
  • Entrez Gene
    Bcan (a.k.a. Cspg7)
  • Entrez Gene
    Ntrk1 (a.k.a. Tkr, TrkA, trk)
  • Tag / Fusion Protein
    • FLAG-Cas9

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer GATGTTGTAGTAAATTTGGG
  • 3′ sequencing primer ATCATGTCTGGATCTCCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Adeno BN was a gift from Andrea Ventura (Addgene plasmid # 101823 ; http://n2t.net/addgene:101823 ; RRID:Addgene_101823)
  • For your References section:

    Somatic chromosomal engineering identifies BCAN-NTRK1 as a potent glioma driver and therapeutic target. Cook PJ, Thomas R, Kannan R, de Leon ES, Drilon A, Rosenblum MK, Scaltriti M, Benezra R, Ventura A. Nat Commun. 2017 Jul 11;8:15987. doi: 10.1038/ncomms15987. 10.1038/ncomms15987 PubMed 28695888