pGL4-ERSE2-luc2P-Hygro
(Plasmid #101790)

• Purpose: Luciferase reporter plasmid containing three tandem repeats of the ER stress response element-II (ERSE-II)
• Depositing Lab: Seiichi Oyadomari
• Publication: Fujita et al Acta Med Okayama. 2020 Jun;74(3):199-208. doi: 10.18926/AMO/59950.

Backbone

• Vector backbone: pGL4.29
• Backbone manufacturer: Promega
• Vector type: Mammalian Expression, Luciferase
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3xERSE-II
• Species: Synthetic
• Insert Size (bp): 105
• Promoter: minimal TATA-box promoter with low basal activity
• Tag / Fusion Protein:
  • Luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: ctaactggccggtacctgag
• 3′ sequencing primer: aacagtaccggattgccaag

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry